Review



gpi1  (Sino Biological)


Bioz Verified Symbol Sino Biological is a verified supplier
Bioz Manufacturer Symbol Sino Biological manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Sino Biological gpi1
    Gpi1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gpi1/gpi1/custom%40gpi1%4034970493
    Average 90 stars, based on 1 article reviews
    gpi1 - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    other:

    Article Title: Mitochondrial Ndufa4l2 Enhances Deposition of Lipids and Expression of Ca9 in the TRACK Model of Early Clear Cell Renal Cell Carcinoma
    Article Snippet: 1:1000 1:200 16480-1 00007801 ProteinTech rabbit Eno1 1:1000 1:200 11204-1-AP 00014144 ProteinTech rabbit GFP 1:1000 1:200 STJ140006 000666270214 St.John’s Lab goat Car9 NA 1:200 50660-R001 HA07MC0806 Sino Biological rabbit Gpi1 1:1000 1:200 15171-1-AP 00007145 ProteinTech rabbit Ggt1 NA 1:200 A1776 0006510201 AbClonal rabbit Sglt1 NA 1:200 PA5-88282 WC3216903 Thermo rabbit Aqp1 NA 1:200 MA5-32593



    Similar Products

    gpi1  (Sino Biological)
    90
    Sino Biological gpi1
    Gpi1, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gpi1/gpi1/custom%40gpi1%4034970493
    Average 90 stars, based on 1 article reviews
    gpi1 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    gpi1  (Thermo Fisher)
    90
    Thermo Fisher gpi1
    Gpi1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gpi1/pm36543778-512-32-33
    Average 90 stars, based on 1 article reviews
    gpi1 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    gene exp gpi1 mm01962484 u1  (Thermo Fisher)
    94
    Thermo Fisher gene exp gpi1 mm01962484 u1
    Gene Exp Gpi1 Mm01962484 U1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gpi1/Gene+Exp%2E+Gpi1%2C+Mm01962484_u1/pm41408829-83-93--1
    Average 94 stars, based on 1 article reviews
    gene exp gpi1 mm01962484 u1 - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    gpi1 -r tgtactttccgttggactcc  (Bioneer Corporation)
    90
    Bioneer Corporation gpi1 -r tgtactttccgttggactcc
    Gpi1 R Tgtactttccgttggactcc, supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gpi1/gpi1++r+tgtactttccgttggactcc/pmc11217295-166-54-66
    Average 90 stars, based on 1 article reviews
    gpi1 -r tgtactttccgttggactcc - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    gpi1  (Proteintech)
    93
    Proteintech gpi1
    Gpi1, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gpi1/GPI+Antibody/pmc08776480-47-59-60
    Average 93 stars, based on 1 article reviews
    gpi1 - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier

    Image Search Results